After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PROCR ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PROCR cDNA Clone Product Information
Gene_bank_ref_id:BC014451
RefSeq ORF Size:717bp
cDNA Description:Full length Clone DNA of Homo sapiens protein C receptor, endothelial (EPCR) with N terminal His tag.
Gene Synonym:CCCA, EPCR, CCD41, CD201, bA42O4.2, PROCR
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR, is a receptor for Protein C. Protein C plays an important role in many metabolism processes in humans and other animals after activated by binding to Endothelial protein C receptor (EPCR). Because of the EPCR is found primarily on endothelial cells (cells on the inside of blood vessels), activated protein C is found maily near endothelial cells. Protein C is pleiotropic, with two main functions: anticoagulation and cytoprotection. Which function will be performed depend on whether or not protein C remains bind to EPCR after activated. The anticoagulation occurs when it does not. In this case, protein C functions as an anticoagulant by irreversibly proteolytically inactivating Factor Va and Factor VIIIa, turning them into Factor Vi and Factor VIIIi respectively. When still bound to EPCR, activated protein C performs its cytoprotective effects, acting on the effector substrate PAR-1, protease-activated receptor-1. To a degree, APC's anticoagulant properties are independent of its cytoprotective ones, in that expression of one pathway is not affected by the existence of the other. 

References
  • Nicolaes GA, et al. (2003). Congenital and acquired activated protein C resistance. Semin Vasc Med. 3 (1): 33-46.
  • Esmon CT. ( 2003). The protein C pathway. Chest 124 (3): 26-32.
  • Mosnier LO, et al. (2007)The cytoprotective protein C pathway. Blood. 109: 3161-72.
  • Size / Price
    Catalog: HG13320-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"