Quick Order

Text Size:AAA

Human SULT1A3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SULT1A3 cDNA Clone Product Information
Gene_bank_ref_id:NM_003166.3
RefSeq ORF Size:888bp
cDNA Description:Full length Clone DNA of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with C terminal HA tag.
Gene Synonym:STM, HAST, HAST3, M-PST, ST1A5, TL-PST, SULT1A4, MGC117469, SULT1A3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SULT1A3 belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. They are different in their tissue distributions and substrate specificities while their gene structure (number and length of exons) is similar. SULT1A3 gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. It is the most centromeric of the four sulfotransferase genes. Exons of this gene overlap with exons of a gene that encodes a protein containing GIY-YIG domains (GIYD1). SULT1A3 is expressed in liver, colon, kidney, lung, brain, spleen, small intestine, placenta and leukocyte. SULT1A3 is a sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of phenolic monoamines (neurotransmitters such as dopamine, norepinephrine and serotonin) and phenolic and catechol drugs.

References
  • Dajani R, et al. (1999) Kinetic properties of human dopamine sulfotransferase (SULT1A3) expressed in prokaryotic and eukaryotic systems: comparison with the recombinant enzyme purified from Escherichia coli. Protein Expr. Purif. 16 (1): 11-8.
  • Dajani R, et al. (2000) X-ray crystal structure of human dopamine sulfotransferase, SULT1A3. J. Biol. Chem. 274 (53): 37862-8.
  • Yasuda S, et al. (2011) Sulfation of chlorotyrosine and nitrotyrosine by human lung endothelial and epithelial cells: role of the human SULT1A3. Toxicol Appl Pharmacol. 251 (2): 104-9.
  • Hildebrandt MA, et al. (2004) Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem Biophys Res Commun. 321 (4): 870-8.
  • Lu JH, et al. (2005) Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'-phosphoadenosine 5'-phosphate. Biochem Biophys Res Commun. 335 (2): 417-23.
  • Size / Price
    Catalog: HG11408-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"