Quick Order

Text Size:AAA

Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTMAcDNA Clone Product Information
Gene_bank_ref_id:NM_001099285.1
cDNA Size:336
cDNA Description:ORF Clone of Homo sapiens prothymosin, alpha DNA.
Gene Synonym:TMSA, MGC104802
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11407-ACG$325
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11407-ACR$325
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11407-ANG$325
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11407-ANR$325
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11407-CF$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11407-CH$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11407-CM$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11407-CY$295
Human PTMA Gene cDNA Clone (full-length ORF Clone)HG11407-M$95
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11407-M-F$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11407-M-N$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11407-NF$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11407-NH$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11407-NM$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11407-NY$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11407-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

PTMA (prothymosin, alpha, N-GST chimera) is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin a1. Thymosins are named becaues they were originally isolated from the thymus. But now in many other tissues, thymosins also can be detected. Thymosins have diverse biological activities, and two in particular, thymosins a1 and _4, have potentially important uses in medicine, some of which have already progressed from the laboratory to the clinic. In general, PTMA is associated with cellular proliferation and carcinogenesis (Eschenfeldt et al., 1986), cellular and viral transcription (Cotter et al., 2000), protection against apoptosis and chromatin remodelling (Karetsou et al., 1998). PTMA may have a dual role both intracellulary and extracellulary. In relation to diseases, thymosins have been categorized as biological response modifiers. Thymosin a1 is derived from PTMA. For animals that lack thymus glands, thymosin a1 is responsible for the activity of that preparation in restoring immune function.

References
  • Manrow RE, et al. (1992) The human prothymosin alpha gene family contains several processed pseudogenes lacking deleterious lesions. Genomics. 13(2):319-31.
  • Wara DW, et al. (1975) Thymosin activity in patients with cellular immunodeficiency. N Engl J Med. 292(2):70-4.
  • Garaci E, et al. (2007) Thymosin alpha 1: from bench to bedside. Ann N Y Acad Sci. 1112:225-34.
  • Goldstein AL, et al. (2009) From lab to bedside: emerging clinical applications of thymosin alpha 1. Expert Opin Biol Ther. 9(5):593-608.
  • Size / Price
    Catalog:HG11407-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"