Quick Order

Human ADH7 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ADH7 cDNA Clone Product Information
NCBI RefSeq:BC131512
RefSeq ORF Size:1161bp
cDNA Description:Full length Clone DNA of Homo sapiens alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide with N terminal Flag tag.
Gene Synonym:ADH4
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Calcium/calmodulin-dependent protein kinase type I I subunit alpha, also known as CaM kinase II subunit alpha, CAMKA, and CAMK2A, is a member of the protein kinase superfamily, CAMK Ser/Thr protein kinase family, and CaMK subfamily. CAMK2A contains one protein kinase domain. CAMK2 is a prominent kinase in the central nervous system that may function in long-term potentiation and neurotransmitter release. As a member of the NMDAR signaling complex in excitatory synapses, it may regulate NMDAR-dependent potentiation of the AMPAR and synaptic plasticity. CAMK2 is composed of four different chains: alpha, beta, gamma, and delta. The different isoforms assemble into homo- or heteromultimeric holoenzymes composed of 8 to 12 subunits. CAMK2 interacts with BAALC, MPDZ, SYN1, CAMK2N2 and SYNGAP1.

References
  • Nagase T., et al., 1999, DNA Res. 6: 63-70.
  • Schmutz J., et al., 2004, Nature. 431: 268-274.
  • Krapivinsky G., et al., 2004, Neuron 43:563-574. 
  • Ignotz,GG. et al., 2005, Biol Reprod. 73 (3): 519-26.
  • Size / Price
    Catalog: HG15947-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"