After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RPE ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RPE cDNA Clone Product Information
Gene_bank_ref_id:BC005148
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Homo sapiens ribulose-5-phosphate-3-epimerase with C terminal His tag.
Gene Synonym:HUSSY-17, MGC2636, RPE2-1, RPE
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

The "ribulose phosphate binding" superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common (beta/alpha)(8)-barrel ancestor. The superfamily includes d-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-l-gulonate 6-phosphate decarboxylase (KGPDC). Replication of the human genome requires the activation of thousands of replicons distributed along each one of the chromosomes. Each replicon contains an initiation, or origin, site, at which DNA synthesis begins. In enzymology, a L-ribulose-5-phosphate 3-epimerase is an enzyme that catalyzes the chemical reaction L-ribulose 5-phosphate to L-xylulose 5-phosphate. Hence, RPE has one substrate, L-ribulose 5-phosphate, and one product, L-xylulose 5-phosphate. RPE belongs to the family of isomerases, specifically those racemases and epimerases acting on carbohydrates and derivatives. The systematic name of this enzyme class is L-ribulose-5-phosphate 3-epimerase. Other names in common use include L-xylulose 5-phosphate 3-epimerase, UlaE, and SgaU.

References
  • Yew WS, et al., 2002,  J. Bacteriol. 184 (1): 302-6.
  • Shimaoka, M. et al., 2005, Biosci Biotechnol Biochem  69 (7):1248-55.
  • Salinero,KK. et al., 2009,  BMC Genomics 10 :351.
  • Size / Price
    Catalog: HG14238-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"