Quick Order

Text Size:AAA

Human tsukushin Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TSKUcDNA Clone Product Information
cDNA Size:1062
cDNA Description:ORF Clone of Homo sapiens tsukushin DNA.
Gene Synonym:TSK, E2IG4, LRRC54
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human TGFBR2 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinHuman BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Mouse Smad5 ProteinMouse BAMBI / NMA Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items