Quick Order

Text Size:AAA

Human TSPAN31 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TSPAN31 cDNA Clone Product Information
Gene_bank_ref_id:BC010377
RefSeq ORF Size:633bp
cDNA Description:Full length Clone DNA of Homo sapiens tetraspanin 31 with C terminal His tag.
Gene Synonym:SAS, TSPAN31
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

References
  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Catalog: HG14231-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"