After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse MAPK14 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAPK14cDNA Clone Product Information
cDNA Size:1083
cDNA Description:ORF Clone of Mus musculus mitogen-activated protein kinase 14 DNA.
Gene Synonym:p38, Crk1, Mxi2, p38a, CSBP2, Csbp1, PRKM14, PRKM15, p38MAPK, p38alpha, MGC102436, p38-alpha, Mapk14
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

MAPK14 contains 1 protein kinase domain and belongs to the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. MAPK14 can be detected in brain, heart, placenta, pancreas and skeletal muscle and it is expressed to a lesser extent in lung, liver and kidney. MAPK14 is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with MAPK14. The substrates of p38 alpha include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of p38 alpha in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. In respond to activation by environmental stress, pro-inflammatory cytokines and lipopolysaccharide, MAPK14 phosphorylates a number of transcription factors, such as ELK1 and ATF2 and several downstream kinases, such as MAPKAPK2 and MAPKAPK5. MAPK14 plays a critical role in the production of some cytokines, for example IL-6. It may play a role in stabilization of EPO mRNA during hypoxic stress. Isoform Mxi2 activation is stimulated by mitogens and oxidative stress and only poorly phosphorylates ELK1 and ATF2.

  • Luo X, et al. (2011) Study on p38 mitogen activated protein kinase in vascular endothelial cells dysfunction in preeclampsia. Zhonghua Fu Chan Ke Za Zhi. 46(1):36-40.
  • Park CH, et al. (2011) Epidermal growth factor-induced matrix metalloproteinase-1 expression is negatively regulated by p38 MAPK in human skin fibroblasts. J Dermatol Sci. 64(2):134-41.
  • Lee JY, et al. (2011) Curcumin induces EGFR degradation in lung adenocarcinoma and modulates p38 activation in intestine: the versatile adjuvant for gefitinib therapy. PLoS One. 6(8):e23756.
  • Riis JL, et al. (2011) CCL27 expression is regulated by both p38 MAPK and IKKβ signalling pathways. Cytokine. 56(3):699-707.