After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LRRTM4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LRRTM4 cDNA Clone Product Information
Gene_bank_ref_id:NM_001134745.1
RefSeq ORF Size:1773bp
cDNA Description:Full length Clone DNA of Homo sapiens leucine rich repeat transmembrane neuronal 4 with C terminal HA tag.
Gene Synonym:FLJ12568, MGC120633, MGC120636, LRRTM4
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Leucine-rich repeat transmembrane neuronal protein 4, also known as LRRTM4, is a single-pass type I  membrane protein which belongs to the LRRTM family. LRRTM4 is expressed in the limb mesenchyme, neural tube, caudal mesoderm and in three distinct regions of the head. LRRTM4 may play a role in the development and maintenance of the vertebrate nervous system. Leucine-rich repeat containing proteins are involved in protein-protein interactions and they regulate numerous cellular events during nervous system development and disease. Human and mouse LRRTMs are highly conserved, and orthologous genes exist in other vertebrates but not in invertebrates. LRRTM mRNAs are predominantly expressed in the nervous system and that each LRRTM possesses a specific, partially nonoverlapping expression pattern. The structure and expression profile of LRRTM mRNAs suggest that they may have a role in the development and maintenance of the vertebrate nervous system. All LRRTMs, except LRRTM4, are located in the introns of different alpha-catenin genes, suggesting coevolution of these two gene families.

References
  • Laurén,J. et al., 2003, Genomics 81 (4):411-21.
  • Clark HF. et al.,2003, Genome Res. 13: 2265-70.
  • Haines,BP. et al., 2007,Gene Expr Patterns  7 (1-2): 23-9.
  • Size / Price
    Catalog: HG11387-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"