Quick Order

Text Size:AAA

Human AIF1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AIF1 cDNA Clone Product Information
NCBI RefSeq:BC009474
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1 with C terminal His tag.
Gene Synonym:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Catalog: HG14227-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"