After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse THBD Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
THBDcDNA Clone Product Information
Gene_bank_ref_id:NM_009378.3
cDNA Size:1734
cDNA Description:ORF Clone of Mus musculus thrombomodulin DNA.
Gene Synonym:TM, CD141, AI385582, Thbd
Species:Mouse
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Thrombomodulin, also known as THBD(CD141), is an integral membrane protein which reduces blood coagulation by converting thrombin to an anticoagulant enzyme from a procoagulant enzyme. Thrombomodulin is expressed on the surface of endothelial cells and serves as a cofactor for thrombin. It is also expressed on human mesothelial cell, monocyte and a dendritic cell subset. Thrombomodulin functions as a cofactor in the thrombin-induced activation of protein C in the anticoagulant pathway by forming a 1:1 stoichiometric complex with thrombin. Thrombomodulin also regulates C3b inactivation by factor I. Mutations in the thrombomodulin gene have also been reported to be associated with atypical hemolytic-uremic syndrome.

References
  • Dzionek A, et al. (2002) Plasmacytoid dendritic cells: from specific surface markers to specific cellular functions. Hum Immunol. 63(12):1133-48.
  • Dzionek A, et al. (2000) BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol. 165(11):6037-46.
  • Wen DZ, et al. (1987) Human thrombomodulin: complete cDNA sequence and chromosome localization of the gene. Biochemistry. 26(14):4350-7.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"