Quick Order

Human ACE2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACE2cDNA Clone Product Information
cDNA Size:2418
cDNA Description:ORF Clone of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 DNA.
Gene Synonym:ACE2, ACEH, DKFZP434A014
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE activity. Accumulating evidence in recent years has demonstrated a physiological and pathological role of ACE2 in the cardiovascular, renal and respiratory systems. ACE2 also has an important role in blood pressure control. This enzyme, an homolog of ACE, hydrolyzes angiotensin (Ang) I to produce Ang-(1-9), which is subsequently converted into Ang-(1-7) by a neutral endopeptidase and ACE. ACE2 releases Ang-(1-7) more efficiently than its catalysis of Ang-(1-9) by cleavage of Pro(7)-Phe(8) bound in Ang II. Thus, the major biologically active product of ACE2 is Ang-(1-7), which is considered to be a beneficial peptide of the RAS cascade in the cardiovascular system. A physiological role for ACE2 has been implicated in hypertension, cardiac function, heart function and diabetes, and as a receptor of the severe acute respiratory syndrome coronavirus. In the acute respiratory distress syndrome (ARDS), ACE, AngII, and AT1R promote the disease pathogenesis, whereas ACE2 and the AT2R protect from ARDS. Importantly, ACE2 has been identified as a key SARS-coronavirus receptor and plays a protective role in severe acute respiratory syndrome (SARS) pathogenesis. Furthermore, the recent explosion of research into the ACE2 homolog, collectrin, has revealed a new physiological function of ACE2 as an amino acid transporter, which explains the pathogenic role of gene mutations in Hartnup disorder. This review summarizes and discusses the recently unveiled roles for ACE2 in disease pathogenesis.

  • Koitka A, et al. (2008) Angiotensin converting enzyme 2 in the kidney. Clin Exp Pharmacol Physiol. 35(4): 420-5.
  • Raizada MK, et al. (2007) ACE2: a new target for cardiovascular disease therapeutics. J Cardiovasc Pharmacol. 50(2): 112-9.
  • Imai Y, et al. (2007) Angiotensin-converting enzyme 2 (ACE2) in disease pathogenesis. Circ J. 74(3): 405-10.
  • Turner AJ, et al. (2004) ACE2: from vasopeptidase to SARS virus receptor. Trends Pharmacol Sci. 25(6): 291-4.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items