Quick Order

Text Size:AAA

Human BPIFB1 / C20ORF114 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BPIFB1cDNA Clone Product Information
Gene_bank_ref_id:BC008429
cDNA Size:1455
cDNA Description:ORF Clone of Homo sapiens chromosome 20 open reading frame 114 DNA.
Gene Synonym:LPLUNC1, C20orf114, BPIFB1
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

BPIFB1, also known as LPLUNC1, belongs to the BPI/LBP/Plunc superfamily, plunc family. BPIFB1 may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. BPIFB1 is expressed in the upper respiratory tract and oral cavity, which may function in host defence. The expression of BPIF proteins is associated with CF lung disease in humans and mice. It is unclear if this elevation of protein production, which results from phenotypic alteration of the cells within the diseased epithelium, plays a role in the pathogenesis of the disease. BPIFB1 is an abundant, secreted product of goblet cells and minor mucosal glands of the respiratory tract and oral cavity and suggest that the protein functions in the complex milieu that protects the mucosal surfaces in these locations.

Size / Price
Catalog:HG13275-NH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"