Quick Order

Human S6K / RPS6KB1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RPS6KB1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003161.2
RefSeq ORF Size:1578bp
cDNA Description:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 with N terminal HA tag.
Gene Synonym:RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

References
  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
  • Size / Price
    Catalog: HG10099-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"