After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse FZD5 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FZD5 cDNA Clone Product Information
Gene_bank_ref_id:NM_001042659.1
RefSeq ORF Size:1758bp
cDNA Description:Full length Clone DNA of Mus musculus frizzled homolog 5 (Drosophila) with C terminal Myc tag.
Gene Synonym:Fz5, Fz-5, mFz5, AI427138, MGC141642, 5330434N09Rik, Fzd5
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

Wnt signaling is involved in a variety of embryonic development processes of nonvertebrates and vertebrates, where it determines cell motility, cell polarity, differentiation, proliferation and apoptosis, as well as formation of neural synapses. Various homologs of the Wingless protein, termed WNT factors, represent key mediators and act through a receptor complex comprised of members of the Frizzled and low density lipoprotein-related receptors (LRP). 19 WNTs, 10 Frizzled, and 2 LRP proteins have been identified. Frizzled is a family of G protein-coupled receptor proteins consisting of a divergent signal peptide, a highly conserved extracellular cysteine-rich domain (CRD), a variable-length linker region, a seven-pass transmembrane domain, and a variable-length C-terminal tail.Frizzled 5 (FZD5) is believed to be the receptor for the Wnt5A ligand, and also interactions with Wnt10B, Wnt2B, and Wnt 7A functionally. Recent studies of WNT5A/Frizzled-5 signaling have revealed an unexpected and novel role in orchestrating adaptive immunity in response to microbial stimulation. In addition, FZD5 is also implicated in the survival of mature neurons in the parafascicular nucleus of the thalamus.

Size / Price
Catalog: MG50772-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"