After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CTSL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTSVcDNA Clone Product Information
cDNA Size:1005
cDNA Description:ORF Clone of Homo sapiens Homo sapiens cathepsin L2 DNA.
Gene Synonym:CTSL2, CTSU, CTSV, CATL2, MGC125957
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Cathepsin V (CTSV), also known as Cathepsin L2, CTSL2, and CATL2, is a member of the peptidase C1 family. It is predominantly expressed in the thymus and testis. Cathepsin V is also expressed in corneal epithelium, and to a lesser extent in conjuctival epithelium and skin. It is a lysosomal cysteine proteinase that may play an important role in corneal physiology. It has about 75% protein sequence identity to murine cathepsin L. The fold of this enzyme is similar to the fold adopted by other members of the papain superfamily of cysteine proteases. Cathepsin V has been recently described as highly homologous to Cathepsin L and exclusively expressed in human thymus and testis. Cathepsin V is the dominant cysteine protease in cortical human thymic epithelial cells, while Cathepsin L and Cathepsin S seem to be restricted to dendritic and macrophage-like cells. Active Cathepsin V in thymic lysosomal preparations was demonstrated by active-site labeling. Recombinant Cathepsin V was capable of converting Ii into CLIP efficiently, suggesting that it is the protease that controls the generation of alphabeta-CLIP complexes in the human thymus. Cathepsin V is the third elastolytic cysteine protease which exhibits the most potent elastase activity yet described among human proteases and that it is present in atherosclerotic plaque specimens. Cathepsin L2 may play a specialized role in the thymus and testis. Expression analysis of cathepsin L2 in human tumors revealed a widespread expression in colorectal and breast carcinomas but not in normal colon or mammary gland or in peritumoral tissues. Cathepsin L2 was also expressed by colorectal and breast cancer cell lines as well as by some tumors of diverse origin, including ovarian and renal carcinomas.

  • Itoh R, et al. (1999) Genomic organization and chromosomal localization of the human cathepsin L2 gene. DNA Res. 6(2): 137-40.
  • Tolosa E, et al. (2003) Cathepsin V is involved in the degradation of invariant chain in human thymus and is overexpressed in myasthenia gravis. J Clin Invest. 112(4): 517-26.
  • Yasuda Y, et al. (2004) Cathepsin V, a novel and potent elastolytic activity expressed in activated macrophages. J Biol Chem. 279(35): 36761-70.
  • Puzer L, et al. (2008) Cathepsin V, but not cathepsins L, B and K, may release angiostatin-like fragments from plasminogen. Biol Chem. 389(2): 195-200.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items