Quick Order

Text Size:AAA

Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AKT1S1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001098632.1
RefSeq ORF Size:771bp
cDNA Description:Full length Clone DNA of Homo sapiens AKT1 substrate 1 (proline-rich), transcript variant 2 with N terminal HA tag.
Gene Synonym:AKT1S1, Lob, PRAS40, MGC2865
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-HA tag on other vectors
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-GFPSpark tagHG10092-ACG$325
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10092-ACR$325
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-GFPSpark tagHG10092-ANG$325
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10092-ANR$325
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-Flag tagHG10092-CF$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-His tagHG10092-CH$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-Myc tagHG10092-CM$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-HA tagHG10092-CY$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA clone plasmidHG10092-M$195
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, Flag tagHG10092-M-F$395
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-Flag tagHG10092-NF$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-His tagHG10092-NH$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-Myc tagHG10092-NM$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-HA tagHG10092-NY$295
Human AKT1S1 / PRAS40 transcript variant 2 natural ORF mammalian expression plasmidHG10092-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10092-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"