Quick Order

Text Size:AAA

Mouse BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BIRC2cDNA Clone Product Information
cDNA Size:1839
cDNA Description:ORF Clone of Mus musculus baculoviral IAP repeat-containing 2 DNA.
Gene Synonym:Api1, Api2, IAP1, IAP2, MIHB, MIHC, Birc3, HIAP1, HIAP2, MIAP1, MIAP2, RNF48, cIAP1, cIAP2, mcIAP1, AW146227, Birc2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

The cellular inhibitor of apoptosis protein-1 (cIAP1) is a member of the Inhibitor of Apoptosis family proteinsare (IAP) whose members are characterized by a novel domain of about 70 amino acids termed baculoviral IAP repeats (BIRs). The BIR domains of cIAP1 and cIAP2 bind to caspases, the key effector proteases of apoptosis. The IAP protein family which can enhance cell survival are crucial regulators of programmed cell death. Both cIAP1 and cIAP2 are the E3 ubiquitin protein isopeptide ligases for Smac, taking part in promoting cancer survival through functioning as E3 ubiqitin ligases. Removal of cIAP1 by genetic deletion may result in NF-κB signaling activation that induces TNFα production and in killing sensitive tumor cells through enhanced TNF-R1 death-receptor signaling and caspase 8 activation. The substrate-dependent E3 activity of cIAPs is mediated by their RING domains and is dependent on the specific interactions between cIAPs and Smac. cIAP1 and cIAP2 are also reported to be regulators of NF-kB activation upon TNFαtreatment.

  • Vince JE, et al. (2007) IAP Antagonists Target cIAP1 to Induce TNF-Dependent Apoptosis. Cell. 131(4): 682-93.
  • Hu SM, et al. et al. (2003) Cellular Inhibitor of Apoptosis 1 and 2 Are Ubiquitin Ligases for the Apoptosis Inducer Smac/DIABLO. The Journal of Biological Chemistry. 278: 10055-60.
  • Imoto I, et al. (2011) Identification of cIAP1 As a Candidate Target Gene within an Amplicon at 11q22 in Esophageal Squamous Cell Carcinomas 1. Cancer Res. 61: 6629.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items