Quick Order

Mouse LILRB3 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LILRB3 cDNA Clone Product Information
Gene_bank_ref_id:NM_011095.1
RefSeq ORF Size:2526bp
cDNA Description:Full length Clone DNA of Mus musculus leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 with C terminal Myc tag.
Gene Synonym:Gp91, Pirb, Lilrb3
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Leukocyte immunoglobulin-like receptor subfamily B member 3, also known as Leukocyte immunoglobulin-like receptor 3, Immunoglobulin-like transcript 5, Monocyte inhibitory receptor HL9, CD85 antigen-like family member A, CD85a and LILRB3, is a single-pass type I  membrane protein which belongs to the leukocyte receptor cluster (LRC) present on 19q13.4. LILRB3 / CD85a contains four Ig-like C2-type (immunoglobulin-like) domains. LILRB3 / CD85a contains three copies of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases. LILRB3 / CD85a is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found.

References
  • Huang,J. et al., 2010, J Virol. 84 (18): 9463-71.
  • Arm J.P. et al., 1997, J. Immunol. 159:2342-2349.
  • Wende H. et al., 2000, Immunogenetics 51:703-713.
  • Yu L.-R. et al., 2007,J. Proteome Res. 6:4150-4162.
  • Size / Price
    Catalog: MG50760-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"