After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human GOT1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GOT1 cDNA Clone Product Information
Gene_bank_ref_id:BC000498
RefSeq ORF Size:1242bp
cDNA Description:Full length Clone DNA of Homo sapiens glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with C terminal His tag.
Gene Synonym:ASTQTL1, GIG18, GOT1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

References
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catalog: HG14196-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"