Quick Order

Human CDCP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDCP1cDNA Clone Product Information
cDNA Size:1032
cDNA Description:ORF Clone of Homo sapiens CUB domain containing protein 1 DNA.
Gene Synonym:CD318, TRASK, SIMA135, CDCP1p
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CDCP1 contains three extracellular CUB domains. It is a putative stem cell marker that is highly expressed in some human cancer cells and in both, typical and atypical (cancerous) colons. It interacts with CDH2/N-cadherin, CDH3/P-cadherin, SDC1/syndecan-1, SDC4/syndecan-4 and the serine protease ST14/MT-SP1. It also interacts with SRC and PRKCG/protein kinase C gamma. CDCP1 is taken as a key regulator of EGF/EGFR-induced cell migration. It has been shown that signaling via EGF/EGFR induces migration of ovarian cancer Caov3 and OVCA420 cells with concomitant up-regulation of CDCP1 mRNA and protein. Consistent with a role in cell migration CDCP1 relocates from cell-cell junctions to punctate structures on filopodia after activation of EGFR. It may be involved in cell adhesion and cell matrix association. It also may play a role in the regulation of anchorage versus migration or proliferation versus differentiation via its phosphorylation. It has been taken as a novel marker for leukemia diagnosis and for immature hematopoietic stem cell subsets.

  • Conze T, et al.. (2003) CDCP1 is a novel marker for hematopoietic stem cells. Ann N Y Acad Sci. 996 (1): 222-6.
  • Hooper JD, et al. (2003) Subtractive immunization using highly metastatic human tumor cells identifies SIMA135/CDCP1, a 135 kDa cell surface phosphorylated glycoprotein antigen. Oncogene. 22(12): 1783-94.
  • Scherl-Mostageer M, et al. (2001) Identification of a novel gene, CDCP1, overexpressed in human colorectal cancer. Oncogene. 20(32):4402-8.