Quick Order

Text Size:AAA

Mouse CDH2 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CDH2 cDNA Clone Product Information
Gene_bank_ref_id:NM_007664.4
RefSeq ORF Size:2721bp
cDNA Description:Full length Clone DNA of Mus musculus cadherin 2 with C terminal Myc tag.
Gene Synonym:CDHN, Ncad, N-cadherin, Cdh2
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 (NCAD) has been shown to play an essential role in normal neuronal development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. In addition, N-Cadherin expression was upregulated in human HSC during activation in culture, and function or expression blocking of N-Cadherin promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20-100 kDa fragments. It may provide a novel target for therapies that are directed toward intimal proliferative disorders, including restenosis and vascular bypass graft failure. N-Cadherin is associated with tumor aggressiveness and metastatic potential and may contribute to tumor progression.

References
  • Jones M, et al. (2002) N-cadherin upregulation and function in response of smooth muscle cells to arterial injury. Arterioscler Thromb Vasc Biol. 22(12): 1972-7.
  • Nagi C, et al. (2005) N-cadherin expression in breast cancer: correlation with an aggressive histologic variant--invasive micropapillary carcinoma. Breast Cancer Res Treat. 94(3): 225-35.
  • Schrick C, et al. (2007) N-cadherin regulates cytoskeletally associated IQGAP1/ERK signaling and memory formation. Neuron. 55(5): 786-98.
  • Li K, et al. (2010) Downregulation of N-cadherin expression inhibits invasiveness, arrests cell cycle and induces cell apoptosis in esophageal squamous cell carcinoma. Cancer Invest. 28(5): 479-86.
  • Size / Price
    Catalog: MG50752-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"