Quick Order

Human MYC Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MYCcDNA Clone Product Information
cDNA Size:1407
cDNA Description:ORF Clone of Homo sapiens v-myc myelocytomatosis viral oncogene homolog (avian) DNA.
Gene Synonym:c-Myc, bHLHe39, MYC
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human MYC Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

Myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein. It can help to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. Myc Tag also can be used to isolate protein complexes with multiple subunits. The Myc Tag Antibody is produced by the conjugation of a synthetic Myc tag peptide to KLH. Myc Tag Antibody can be used in various immunoassays, such as ELISA, Western blotting, immunoprecipitation, immunofluorescence, and more.

  • Ding X, et al., 2009, PLoS One. 4(6): e5949.
  • Ratsima H, et al., 2011, Proc Natl Acad Sci. 108(43): E914-23.
  • Chiang YJ, et al., 2013, PLoS One. 8(4): e61761.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Human MYC Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged