Quick Order

Human BDNF transcript variant 4 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BDNF cDNA Clone Product Information
Gene_bank_ref_id:NM_001709.3
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Homo sapiens brain-derived neurotrophic factor (BDNF), transcript variant 4 with N terminal HA tag.
Gene Synonym:BDNF, MGC34632
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

BDNF is a member of the nerve growth factor family. It is highly expressed in hippocampus, amygdala, cerebral cortex and cerebellum. It also can be detected in heart, lung, skeletal muscle, testis, prostate and placenta. BDNF is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. During development, BDNF promotes the survival and differentiation of selected neuronal populations of the peripheral and central nervous systems. It participates in axonal growth, pathfinding and in the modulation of dendritic growth and morphology. It functions as the major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability.

References
  • Zigova T, et al. (1998) Intraventricular administration of BDNF increases the number of newly generated neurons in the adult olfactory bulb. Mol Cell Neurosci. 11(4):234-45.
  • Acheson A, et al. (1995) A BDNF autocrine loop in adult sensory neurons prevents cell death. Nature 374(6521):450-3.
  • Bekinschtein P, et al. (2008) BDNF is essential to promote persistence of long-term memory storage. Proc Natl Acad Sci. 105(7):2711-6.
  • Size / Price
    Catalog: HG10068-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"