After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD59A ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse CD59A cDNA Clone Product Information
NCBI RefSeq:NM_007652.4
RefSeq ORF Size:372bp
cDNA Description:Full length Clone DNA of Mus musculus CD59 antigen with C terminal Myc tag.
Gene Synonym:Cd59, AA987121, protectin, Cd59a
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Protectin, a complement regulatory protein, also known as CD59, or MIRL (membrane inhibitor of reactive lysis) is a small protein that inhibits the complement membrane attack complex by binding C5b678 and preventing C9 from binding and polymerizing. The amino-terminal 25 amino acids represented a typical signal peptide sequence and the carboxy-terminal hydrophobic amino acids were characteristic for phosphatidylinositol-anchored proteins.It was found that the CD59/Protectin antigen is a small protein sometimes associated with larger components (45 and 80 kD) in urine. CD59/Protectin antigen was released from the surface of transfected COS cells by phosphatidylinositol-specific phospholipase C, demonstrating that it is attached to the cell membrane by means of a glycolipid anchor; it is therefore likely to be absent from the surface of affected erythrocytes in the disease paroxysmal nocturnal hemoglobinuria.

References
  • Huang Y, et al. (2006) Defining the CD59-C9 binding interaction. J Biol Chem. 281 (37): 27398-404.
  • Sawada R, et al. (1990) Isolation and expression of the full-length cDNA encoding CD59 antigen of human lymphocytes. DNA Cell Biol. 9(3): 213-20.
  • Philbrick WM, et al. (1990) The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility. Eur J Immunol. 20(1): 87-92.
  • Size / Price
    Catalog: MG50724-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"