After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CST9L ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CST9L cDNA Clone Product Information
Gene_bank_ref_id:BC029656
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin 9-like with N terminal His tag.
Gene Synonym:bA218C14.1, CST9L
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Testatin is a member of the Cystatin family. Cystatins comprise genes that all show expression patterns that are strikingly restricted to reproductive tissue. Cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. There are typically about 115 amino acids in this family. They are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds, may be glycosylated and/or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Testatin shows homology to family 2 cystatins, a group of broadly expressed small secretory proteins that are inhibitors of cysteine proteases in vitro but whose in vivo functions are unclear. It is expressed in germ cells and somatic cells in reproductive tissues. Testatin is considered a strong candidate for involvement in early testis development. Testatin expression is maintained in the adult Sertoli cell, and it can also be found in a small population of germ cells.

References
  • Dickinson DP, et al. (1993) Genomic cloning, physical mapping, and expression of human type 2 cystatin genes. Crit Rev Oral Biol. 4(3-4):573-80.
  • Dickinson DP, et al. (1995) Direct mapping of seven genes encoding human type 2 cystatins to a single site located at 20p11.2. Genomics. 24(1):172-5.
  • Thiesse M, et al. (1994) The human type 2 cystatin gene family consists of eight to nine members, with at least seven genes clustered at a single locus on human chromosome 20. DNA Cell Biol. 13(2): 97-116.
  • Size / Price
    Catalog: HG13243-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"