After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AZGP1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AZGP1 cDNA Clone Product Information
Gene_bank_ref_id:BC033830
RefSeq ORF Size:897bp
cDNA Description:Full length Clone DNA of Homo sapiens alpha-2-glycoprotein 1, zinc-binding with N terminal His tag.
Gene Synonym:ZAG, ZA2G, AZGP1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Alpha-2-glycoprotein, also known as AZGP1, belongs to the MHC class I family. It can be detected in body fluids such as serum, sweat, and seminal and breast cyst fluids. It has been shown that alpha-2-glycoprotein can stimulate lipolysis by adipocytes in vivo and in vitro. Thus it is believed that alpha-2-glycoprotein plays an important role in the regulation of body weight, and age-dependent changes in genetically influenced obesity, and it also regulates melanin production by normal and malignant melanocytes. Alpha-2-glycoprotein is produced by both white and brown fat adipocytes and may act in a local autocrine fashion in the reduction of adiposity in cachexia.

References
  • Tada T, et al. (1991) Immunohistochemical localization of Zn-alpha 2-glycoprotein in normal human tissues. J Histochem Cytochem. 39(9):1221-6.
  • Vanni H, et al. (2009) Cigarette Smoking Induces Overexpression of a Fat-Depleting Gene AZGP1 in the Human. Chest. 135(5):1197-208.
  • Ueyama H, et al. (1991) Cloning and nucleotide sequence of a human Zn-alpha 2-glycoprotein cDNA and chromosomal assignment of its gene. Biochem Biophys Res Commun. 177(2):696-703.
  • Size / Price
    Catalog: HG13242-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"