Quick Order

Human AKR1C2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AKR1C2 cDNA Clone Product Information
Gene_bank_ref_id:BC007024
RefSeq ORF Size:972bp
cDNA Description:Full length Clone DNA of Homo sapiens aldo-keto reductase family 1, member C2 with C terminal His tag.
Gene Synonym:AKR1C-pseudo, BABP, DD, DD2, DDH2, FLJ53800, HAKRD, HBAB, MCDR2, SRXY8, AKR1C2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

AKR1C2 is a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols using NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme binds bile acid with high affinity, and shows minimal 3-alpha-hydroxysteroid dehydrogenase activity. AKR1C2 gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding two different isoforms have been found for AKR1C2 gene.

References
  • Jin Y. et al., 2011, Biochem J. 437 (1): 53-61.
  • Veilleux A. et al., 2012, Am J Physiol Endocrinol Metab. 302 (8): E941-9.
  • Kuang P. et al., 2012, Lung Cancer. 77 (2): 427-32.
  • Size / Price
    Catalog: HG14175-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"