Quick Order

Text Size:AAA

Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BCL2L2cDNA Clone Product Information
cDNA Size:582
cDNA Description:ORF Clone of Homo sapiens BCL2-like 2 DNA.
Gene Synonym:BCL2L2, BCLW, BCL-W, KIAA0271
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10059-ACG$325
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10059-ACR$325
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10059-ANG$325
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10059-ANR$325
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10059-CF$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10059-CH$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10059-CM$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10059-CY$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone)HG10059-M$95
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10059-M-F$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10059-NF$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10059-NH$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10059-NM$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10059-NY$295
Human BCL2L2 / BCL2-like 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10059-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Beta1,4-Galactosyltransferase-I (B4GALT1), one of seven beta1,4-galactosyltransferases, is an enzyme commonly found in the trans-Golgi complex that adds galactose to oligosaccharides. They have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. B4GALT1 gene directs production of B4GALT1 protein using either of two transcription start sites. The product of the smaller transcript serves the traditional biosynthetic role in the Golgi. This form also complexes with α-lactalbumin, a mammary-specific protein, to form lactose synthase. In addition to a biosynthetic role, the protein translated from the longer transcript appears on the plasma membranes of some cells where it serves as a signalling receptor in cell-matrix interactions such as sperm-egg binding.

  • Hennet T. (2002) The galactosyltransferase family. Cellular and Molecular Life Sciences. 59(7): 1081-95.
  • Landers EA, et al. (2009) Porcine 1, 4-Galactosyltransferase-I Sequence and Expression. Reproduction in Domestic Animals. 44(2): 228-34.
  • Amado M, et al. (2000) Identification and characterization of large galactosyltransferase gene families: galactosyltransferases for all functions. Biochim Biophys Acta. 1473 (1): 35-53.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items