After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PIANP / C12ORF53 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PIANPcDNA Clone Product Information
Gene_bank_ref_id:BC035736
cDNA Size:849
cDNA Description:ORF Clone of Homo sapiens PILR alpha associated neural protein DNA.
Gene Synonym:PANP, C12orf53
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

C12orf53 is mainly expressed in adult brain and cerebellum. It also can be detected in fetal brain and virtually no expression in spleen, heart, kidney, liver and dorsal ganglion relative to brain. C12orf53 acts as a ligand for PILRA in neural tissues, where it may be involved in immune regulation. Chromosome 12 encodes over 1,100 genes within 132 million bases. A number of skeletal deformities are linked to chromosome 12 including hypochondrogenesis, achondrogenesis and Kniest dysplasia. Noonan syndrome, which includes heart and facial developmental defects among the primary symptoms, is caused by a mutant form of PTPN11 gene product, SH-PTP2. Chromosome 12 is also home to a homeobox gene cluster which encodes crucial transcription factors for morphogenesis, and the natural killer complex gene cluster encoding C-type lectin proteins which mediate the NK cell response to MHC class I interaction.

References
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Tissue Antigens. Nat Genet. 36(1):40-5.
  • Kogure A, et al. (2011) PANP is a novel O-glycosylated PILR ligand expressed in neural tissues. Biochem Biophys Res Commun. 405(3):428-33.
  • Size / Price
    Catalog:HG13238-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"