Quick Order

Text Size:AAA

Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAPTcDNA Clone Product Information
cDNA Size:1059
cDNA Description:ORF Clone of Homo sapiens microtubule-associated protein tau (MAPT), transcript variant 4 DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10058-ACG$325
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10058-ACR$325
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10058-ANG$325
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10058-ANR$325
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10058-CF$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10058-CH$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10058-CM$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10058-CY$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone)HG10058-M$195
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10058-M-F$395
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10058-NF$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10058-NH$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10058-NM$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10058-NY$295
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10058-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

MAPT (microtubule-associated protein tau) can produce tau proteins. Tau proteins are proteins that stabilize microtubules. They are abundant in neurons of the central nervous system and are less common elsewhere, but are also expressed at very low levels in CNS astrocytes and oligodendrocytes. When tau proteins are defective, and no longer stabilize microtubules properly, they can result in dementias such as Alzheimer's disease. Tau protein is a highly soluble microtubule-associated protein (MAP). In humans, these proteins are mostly found in neurons compared to non-neuronal cells. One of tau's main functions is to modulate the stability of axonal microtubules. Other nervous system MAPs may perform similar functions, as suggested by tau knockout mice, who did not show abnormalities in brain development - possibly because of compensation in tau deficiency by other MAPs.

  • Harada A, et al. (1994) Altered microtubule organization in small-calibre axons of mice lacking tau protein. Nature. 369(6480):488-91.
  • Weingarten MD, et al. (1975) A protein factor essential for microtubule assembly. Proc Natl Acad Sci. 72(5):1858-62.
  • Goedert M, et al. (1989) Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer's disease. Neuron. 3(4): 519-26.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks