Quick Order

Text Size:AAA

Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CASP7 cDNA Clone Product Information
Gene_bank_ref_id:NM_001227.3
RefSeq ORF Size:912bp
cDNA Description:Full length Clone DNA of Homo sapiens caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha with N terminal HA tag.
Gene Synonym:CASP7, MCH3, CMH-1, ICE-LAP3
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-HA tag on other vectors
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-GFPSpark tagHG10049-ACG$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10049-ACR$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-GFPSpark tagHG10049-ANG$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10049-ANR$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Flag tagHG10049-CF$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-His tagHG10049-CH$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Myc tagHG10049-CM$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-HA tagHG10049-CY$295
Human Caspase-7 transcript variant alpha Gene cDNA clone plasmidHG10049-M$95
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, Flag tagHG10049-M-F$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Flag tagHG10049-NF$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-His tagHG10049-NH$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Myc tagHG10049-NM$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-HA tagHG10049-NY$295
Human Caspase-7 transcript variant alpha natural ORF mammalian expression plasmidHG10049-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play a role in the signal transduction pathways of apoptosis, necrosis and inflammation. There are two major classes of caspases: initiators and effectors. The initiator isoforms (caspases-1,-4,-5,-8,-9,-10,-11,-12) are activated by, and interact with, upstream adaptor molecules through protein-protein interaction domains known as CARD and DED. Effector caspases (-3,-6,-7) are responsible for cleaving downstream substrates and are sometimes referred to as the executioner caspases. Caspase 7 exists in lung, skeletal muscle, liver, kidney, spleen and heart, and moderately in testis. Caspase 7 cannot be detected in the brain. Caspase 7 functions in the activation cascade of caspases responsible for apoptosis execution. It cleaves and activates sterol regulatory element binding proteins (SREBPs). It proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp- -Gly-217' bond. Overexpression promotes programmed cell death.

References
  • Riedl S J, et al. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell. 104(5):791-800.
  • Roy N, et al. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16(23):6914-25.
  • Deveraux Q L, et al. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388(6639): 300-4.
  • Size / Price
    Catalog: HG10049-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"