Quick Order

Text Size:AAA

Human PFKFB3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PFKFB3 cDNA Clone Product Information
Gene_bank_ref_id:BC040482
RefSeq ORF Size:1563bp
cDNA Description:Full length Clone DNA of Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 with N terminal His tag.
Gene Synonym:PFK2, IPFK2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Fructose-2,6-biphosphatase 3, also known as 6-phosphofructo-2-kinase or PFK2 or PFKFB3, is a potent activator of phosphofructokinase, which is a rate-limiting enzyme of glycolysis. Highly phosphorylated PFKFB3 protein was found in human tumor cells, vascular endothelial cells, and smooth muscle cells. Fructose 2,6-bisphosphate (Fru-2,6-BP) is an allosteric activator of 6-phosphofructo-1-kinase (PFK-1), a rate-limiting enzyme and essential control point in glycolysis. The concentration of PFK2 depends on the activity of the bifunctional enzyme, 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFK-2 / FBPase). PFK2 controls the glycolytic flux via the allosteric activator fructose 2,6-bisphosphate. Because of its proto-oncogenic character, the PFK-2/FBPase-2 of the PFKFB3 gene is assumed to play a critical role in tumorigenesis. The hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3) plays a crucial role in the progression of cancerous cells by enabling their glycolytic pathways even under severe hypoxic conditions.

References
  • Kessler R, et al. (2008) 6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB3) is up-regulated in high-grade astrocytomas. J Neurooncol. 86(3):257-64.
  • Yalcin A, et al. (2009) Nuclear targeting of 6-phosphofructo-2-kinase (PFKFB3) increases proliferation via cyclin-dependent kinases. J Biol Chem. 284(36):24223-32.
  • Atsumi T, et al. (2002) High expression of inducible 6-phosphofructo-2-kinase / fructose-2, 6-bisphosphatase (iPFK-2; PFKFB3) in human cancers. Cancer Res. 262(20): 5881-7.
  • Kim SG, et al. (2006) Crystal structure of the hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3): a possible new target for cancer therapy. J Biol Chem. 281(5): 2939-44.
  • Size / Price
    Catalog: HG13230-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"