Quick Order

Mouse TCN2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TCN2cDNA Clone Product Information
cDNA Size:1293
cDNA Description:ORF Clone of Mus musculus transcobalamin 2 DNA.
Gene Synonym:Tcn-2, AW208754, Tcn2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Transcobalamin II, also known as TCN2 and TC II, is a plasma protein that binds cobalamin (Cbl; vitamin B12) as it is absorbed in the terminal ileum and distributes to tissues. The circulating transcobalamin II-cobalamin complex binds to receptors on the plasma membrane of tissue cells and is then internalized by receptor-mediated endocytosis. Transcobalamin II is a non-glycolated secretory protein of molecular mass 43 kDa. Its plasma membrane receptor (TC II-R) is a heavily glycosylated protein with a monomeric molecular mass of 62 kDa. Human TCN2 gene is composed of nine exons and eight introns spanning approximately 20 kb with multiple potential transcription start sites. A number of genetic abnormalities are characterized either by a failure to express TCN2 or by synthesis of an abnormal protein. The TCN2 deficiency results in cellular cobalamin deficiency, an early onset of megaloblastic anaemia, and neurological abnormalities.

  • Rothenberg, S. P. et al., 1995, Baillieres Clin Haematol. 8 (3):499-514.
  • Bibi, H. et al., 1999, J Inherit Metab Dis. 22 (7):765-772.
  • Seetharam,B. et al.,2000, Vitam Horm. 59 :337-366.