After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TP63 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TP63 cDNA Clone Product Information
Gene_bank_ref_id:BC039815
RefSeq ORF Size:2043bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor protein p63 with N terminal His tag.
Gene Synonym:AIS, KET, LMS, NBP, RHS, p40, p51, p63, EEC3, OFC8, p73H, p73L, SHFM4, TP53L, TP73L, p53CP, TP53CP, B(p51A), B(p51B), TP63
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Tumor protein p63 is a protein also known as transformation-related protein 63, TP63, and p63. Tumor protein p63 / p63 is a member of the p53 family of transcription factors whose members P53, p63, and p73 have similar features in their gene structures and functions. An animal model, p63-/- mice has been useful in difining the role p63 plays in the development and maintenance of stratified epithelial tissues. This p63 encoding protein p63 has a dramatic impact on replenishment of cutaneous epithelial stem cells and on ovarian germ cell survival. Although these two fundamental roles of p63 attest to its powerful place in development, its other functions, specifically the apparent capacity of p63, is to supervise the emergence of new cell populations in the breast, prostate, cervix, and upper reproductive tract. P63-/- mice have several development defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Mutations in this protein are associated with ectodermal dysplasia, and cleft lip / palate syndrome 3, ADULT syndrome (acro-dermato-ungual-lacrimal-tooth), limb-mammary syndrome, et al.

References
  • Crum CP, et al. (2010) p63 in epithelial survival, germ cell surveillance, and neoplasia. Annu Rev Pathol. 5: 349-71.
  • Tan M, et al. (2001) p53CP is p51/p63, the third member of the p53 gene family: partial purification and characterization. Carcinogenesis. 22 (2): 295-300.
  • Shiran MS, et al. (2007) p63 as a complementary basal cell specific marker to high molecular weight-cytokeratin in distinguishing prostatic carcinoma from benign prostatic lesions. Med J Malaysia. 62 (1): 36-9.
  • Size / Price
    Catalog: HG13226-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"