After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PPIL1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PPIL1 cDNA Clone Product Information
Gene_bank_ref_id:BC003048
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidylprolyl isomerase (cyclophilin)-like 1 with C terminal His tag.
Gene Synonym:CGI-124, CYPL1, MGC678, PPIase, hCyPX, PPIL1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

PPIL1 is a member of the cyclophilin family. Cyclophilins are well conserved and ubiquitous. Members of cyclophilin family take an significant part in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL1 is a peptidylprolyl isomerase(PPIase). It increases the folding of proteins and catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIL1 is involved in proliferation of cancer cells through modulation of phosphorylation of stathmin. It is a novel molecular target for colon-cancer therapy.

References
  • Xu C. et al., 2005, J Biomol NMR. 31 (2): 179-80.
  • Ozaki K. et al., 1997, Cytogenet Cell Genet. 72 (2-3): 242-5.
  • Mann SS. et al., 1999, Cytogenet Cell Genet. 83 (3-4): 228-9.
  • Size / Price
    Catalog: HG14163-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"