Quick Order

Human SAA4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SAA4cDNA Clone Product Information
cDNA Size:393
cDNA Description:ORF Clone of Homo sapiens serum amyloid A4, constitutive DNA.
Gene Synonym:CSAA, C-SAA, SAA4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

SAA4 is a member of the SAA family.SAA proteins are family of apolipoproteins of high density lipoprotein (HDL). They can be separated into two distinct groups. First group (SAA1, SAA2, and SAA3) consists of acute phase reactant whose expression level increase in the blood in a response to trauma, infection, inflammation, and neoplasia. These acute phase SAAs associates with HDL during inflammation and remodel the HDL particle by displacing Apo-A1. The second distinct group consists of SAA4 and SAA5 which exist as the minor apolipoproteins on HDL, but this group of SAA constitutes more than 90% of all the SAA during homeostasis, and it is thought to play a role in the normal functioning of the HDL particle. SAA4 is a constitutively expressed protein which expressed only in humans and mice.It is connected almost completely with lipoproteins of the high density range. The physiological function of SAA4 is unknown, and its serum concentration has no association with those of other major apolipoproteins.

  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Murphy CL, et al. (2009) AA amyloidosis associated with a mutated serum amyloid A4 protein. Mol Med. Amyloid. 16(2):84-8.
  • Prakash T, et al. (2010) Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. PLoS One. 5(10):e13284.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks