Quick Order

Human 2B4 / CD244 / SLAMF4 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD244 cDNA Clone Product Information
Gene_bank_ref_id:NM_016382.2
RefSeq ORF Size:1098bp
cDNA Description:Full length Clone DNA of Homo sapiens CD244 molecule, natural killer cell receptor 2B4 with N terminal HA tag.
Gene Synonym:2B4, CD244, NAIL, Nmrk, NKR2B4, SLAMF4
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

The CD244 antigen, also known as 2B4, is a cell surface glycoprotein implicated in the regulation of natural killer and T lymphocyte function. 2B4 is a member of the signaling lymphocyte activation molecule (SLAM)-related receptor family and is important for stimulating NK cell cytotoxicity and cytokine production, which is expressed on all NK cells, a subpopulation of T cells, monocytes and basophils. The 2B4 antigen identified on NK cells and T cells is capable of transmitting stimulatory signals and non-MHC-restricted killing. Reported as an activating receptor, human 2B4 can effectively activate and enhance NK cell–mediated cytotoxicity, induce secretion of IFN-γ and matrix metalloproteinases (MMPs), as well as NK cell invasiveness. As a cell surface glycoprotein of the Ig-superfamily structurally related to CD2-like molecules such as CD2, CD48, CD58, CD84, Ly-9, and SLAM, 2B4 (CD244) is expressed on all human NK cells, a subpopulation of T cells, basophils and monocytes. 2B4 activates NK cell mediated cytotoxicity, induces secretion of IFN-gamma and matrix metalloproteinases, and NK cell invasiveness.

References
  • Nakajima H, et al. (2000) 2B4: an NK cell activating receptor with unique specificity and signal transduction mechanism. Hum Immunol. 61(1): 39-43.
  • Chuang SS, et al. (2001) 2B4 (CD244)-mediated activation of cytotoxicity and IFN-gamma release in human NK cells involves distinct pathways. J Immunol. 167(11): 6210-6.
  • McNerney ME, et al. (2005) 2B4 (CD244) is a non-MHC binding receptor with multiple functions on natural killer cells and CD8+ T cells. Mol Immunol. 42(4): 489-94.
  • Mathew SO, et al. (2009) Functional role of human NK cell receptor 2B4 (CD244) isoforms. Eur J Immunol. 39(6): 1632-41.
  • Size / Price
    Catalog: HG10042-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"