Quick Order

Human EED ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human EED cDNA Clone Product Information
NCBI RefSeq:NM_003797.2
RefSeq ORF Size:1326bp
cDNA Description:Full length Clone DNA of Homo sapiens embryonic ectoderm development with C terminal HA tag.
Gene Synonym:HEED, WAIT1, EED
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
References
  • Ura H, et al. (2011) Eed/Sox2 regulatory loop controls ES cell self-renewal through histone methylation and acetylation. EMBO J. 30(11): 2190-204.
  • Montgomery ND, et al. (2007) Molecular and functional mapping of EED motifs required for PRC2-dependent histone methylation. J Mol Biol. 374(5): 1145-57.
  • Jin Q, et al. (2003) The protein phosphatase-1 (PP1) regulator, nuclear inhibitor of PP1 (NIPP1), interacts with the polycomb group protein, embryonic ectoderm development (EED), and functions as a transcriptional repressor. J Biol Chem. 278(33): 30677-85.
  • Showell C, et al. (2002) Identification of putative interaction partners for the Xenopus Polycomb-group protein Xeed. Gene. 291(1-2): 95-104.
  • Rinchik EM, et al. (1993) N-ethyl-N-nitrosourea-induced prenatally lethal mutations define at least two complementation groups within the embryonic ectoderm development (eed) locus in mouse chromosome 7. Mamm Genome. 4(7): 349-53.
  • Size / Price
    Catalog: HG11307-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"