After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ALDOB ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ALDOB cDNA Clone Product Information
Gene_bank_ref_id:NM_000035.3
RefSeq ORF Size:1095bp
cDNA Description:Full length Clone DNA of Homo sapiens aldolase B, fructose-bisphosphate with N terminal His tag.
Gene Synonym:ALDB, ALDO2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Cox TM. (1994) Aldolase B and fructose intolerance. FASEB J. 8(1): 62-71.
  • Malay AD, et al. (2005) Structure of the thermolabile mutant aldolase B, A149P: molecular basis of hereditary fructose intolerance. J Mol Biol. 347(1): 135-44.
  • Susan PP, et al. (2001) Starvation-induced lysosomal degradation of aldolase B requires glutamine 111 in a signal sequence for chaperone-mediated transport. J Cell Physiol. 187(1): 48-58.
  • Size / Price
    Catalog: HG13207-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"