Quick Order

Human PFDN4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PFDN4 cDNA Clone Product Information
Gene_bank_ref_id:BC010953
RefSeq ORF Size:405bp
cDNA Description:Full length Clone DNA of Homo sapiens prefoldin subunit 4 with C terminal His tag.
Gene Synonym:C1, PFD4, PFDN4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

PFDN4 is a member of the prefoldin beta subunit family. It is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. PFDN4 binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. PFDN4 also binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins.

References
  • Iijima M, et al. (1996) Cloning of cDNA with possible transcription factor activity at the G1-S phase transition in human fibroblast cell lines. Acta Med Okayama. 50(2):73-7.
  • Hartl FU, et al. (2002) Molecular chaperones in the cytosol: from nascent chain to folded protein. Science. 295(5561):1852-8.
  • Vainberg I, et al. (1998) Prefoldin, a chaperone that delivers unfolded proteins to cytosolic chaperonin. Cell. 93(5):863-73.
  • Size / Price
    Catalog: HG14144-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"