Quick Order

Text Size:AAA

Human 4EBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EIF4EBP1cDNA Clone Product Information
cDNA Size:357
cDNA Description:ORF Clone of Homo sapiens eukaryotic translation initiation factor 4E binding protein 1 DNA.
Gene Synonym:EIF4EBP1, BP-1, 4EBP1, PHAS-I
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human 4EBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name

The translational suppressor eIF4E binding protein-1, 4E-BP1 functions as a key regulator in cellular growth, differentiation, apoptosis and survival. The Eif4ebp1 gene, encoding 4E-BP1, is a direct target of a transcription factor activating transcription factor-4 (ATF4), a master regulator of gene expression in stress responses. 4E-BP1 is characterized by its capacity to bind specifically to eIF4E and inhibit its interaction with eIF4G. Phosphorylation of 4E-BP1 regulates eIF4E availability, and therefore, cap-dependent translation, in cell stress. Binding of eIF4E to eIF4G is inhibited in a competitive manner by 4E-BP1. Phosphorylation of 4E-BP1 decreases the affinity of this protein for eIF4E, thus favouring the binding of eIF4G and enhancing translation. 4E-BP1 is important for beta-cell survival under endoplasmic reticulum (ER) stress. 4E-BP1 mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways. Recently, 4E-BP1 was found to be a key factor, which converges several oncogenic signals, phosphorylates the molecules, and drives the downstream proliferative signals. Recent studies showed that high expression of phosphorylated 4E-BP-1 (p-4E-BP1) is associated with poor prognosis, tumor progression, or nodal metastasis in different human cancers.

  • Azar R, et al. (2008) Phosphatidylinositol 3-kinase-dependent transcriptional silencing of the translational repressor 4E-BP1. Cell Mol Life Sci. 65(19): 3110-7.
  • Tominaga R, et al. (2010) The JNK pathway modulates expression and phosphorylation of 4E-BP1 in MIN6 pancreatic beta-cells under oxidative stress conditions. Cell Biochem Funct. 28(5): 387-93.
  • Ayuso MI, et al. (2010) New hierarchical phosphorylation pathway of the translational repressor eIF4E-binding protein 1 (4E-BP1) in ischemia-reperfusion stress. J Biol Chem. 285(45): 34355-63.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items