After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Thyroid peroxidase / TPO Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPOcDNA Clone Product Information
Gene_bank_ref_id:NM_000547.5
cDNA Size:2802
cDNA Description:ORF Clone of Homo sapiens thyroid peroxidase DNA.
Gene Synonym:MSA, TPX, TDH2A
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human Thyroid peroxidase / TPO Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name
Background

Thyroid peroxidase is a membrane-bound glycoprotein which belongs to the peroxidase family, XPO subfamily. It contains 1 EGF-like domain and 1 Sushi (CCP/SCR) domain. Thyroid Peroxidase represents one of the main autoantigenic targets in autoimmune thyroid disease of humans. It used to be taken as the formerly so-called `microsomal antigen` several years ago. As an integral membrane glycoprotein it is restricted to the apical plasma membrane of the follicular epithelial cells and comprises two identical subunits of approx 100 kDa molecular weight. Thyroid peroxidase is an enzyme expressed abundantly in the thyroid that liberates iodine for addition onto tyrosine residues on thyroglobulin for the production of thyroxine or triiodothyronine, thyroid hormones. Thyroid peroxidase plays a key role in the thyroid hormone biosynthesis by catalysing both the iodination of tyrosyl residues and the coupling of iodotyrosyl residues in thyroglobulin to form precursors of the thyroid hormones T4 and T3.

References
  • McLachlan SM, et al. (2000) Autoimmune response to the thyroid in humans: thyroid peroxidase--the common autoantigenic denominator. Int Rev Immunol. 19(6):587-618.
  • Nagasaka A, et al. (1976) Effect of antithyroid agents 6-propyl-2-thiouracil and 1-mehtyl-2-mercaptoimidazole on human thyroid iodine peroxidase. J Clin Endocrinol Metab. 43(1): 152-8.
  • Kimura S, et al. (1987) Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs. Proc Natl Acad. 84(16):5555-9.
  • Ruf J, et al. (2006) Structural and functional aspects of thyroid peroxidase. Arch Biochem Biophys. 445 (2):269-77.
  • Size / Price
    Catalog:HG13194-NH
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"