After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCDC134 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCDC134cDNA Clone Product Information
Gene_bank_ref_id:NM_024821.2
cDNA Size:690
cDNA Description:ORF Clone of Homo sapiens coiled-coil domain containing 134 DNA.
Gene Synonym:FLJ22349, MGC21013, dJ821D11.3, CCDC134
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Human coiled-coil domain containing 134 (CCDC134) is a 229 amino acids secretory protein. Coiled-coil domain is a motif in which alpha-helix are coiled together. It has been found in many types of proteins, including transcription factors, intermediate filaments and certain tRNA synthetases. Many proteins containing such motif CCDC134 are involved in important biological functions. CCDC134 is also considered as a novel human MAPK-regulating protein that can inhibit the MAPK pathway. This protein significantly inhibite Elk1 transcriptional activity. The coiled-coil domain is a ubiquitous protein motif that is often involved in oligomerization.

References
  • Huang J, et al. (2007) CCDC134, a novel secretory protein, inhibits activation of ERK and JNK, but not p38 MAPK. Cellular and Molecular Life Sciences. 65(2): 338-49.
  • Kim S, et al. (2011) Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort. Neurology. 76(1): 69-79.
  • Size / Price
    Catalog:HG13168-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"