After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CTNNB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTNNB1cDNA Clone Product Information
cDNA Size:2346
cDNA Description:ORF Clone of Mus musculus catenin (cadherin associated protein), beta 1 DNA.
Gene Synonym:Mesc, Catnb, Ctnnb1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

beta-Catenin, also known as CTNNB1, is a member of the armadillo family of proteins. These proteins have multiple copies of the so-called armadillo repeat domain, which is specialized for protein-protein binding. It is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. CTNNB1 also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, beta-Catenin binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Defects in beta-Catenin can cause colorectal cancer, pilomatrixoma (PTR), medulloblastoma, and ovarian cancer. CTNNB1 is a key dowstream component of the canonical Wnt signaling pathway. In the absence of Wnt, it forms a complex with AXIN1, AXIN2, APC, CSNK1A1 and GSK3B that promotes phosphorylation on N-terminal Ser and Thr residues and ubiquitination of CTNNB1 via BTRC and its subsequent degradation by the proteasome. In the presence of Wnt ligand, beta-Catenin is not ubiquitinated and accumulates in the nucleus, where it acts as a coactivator for transcription factors of the TCF/LEF family, leading to activate Wnt responsive genes. CTNNB1 is involved in the regulation of cell adhesion. The majority of beta-catenin is localized to the cell membrane and is part of E-cadherin/catenin adhesion complexes which are proposed to couple cadherins to the actin cytoskeleton.

  • Yang, et al. (2002) Linking β-catenin to androgen-signaling pathway. J Biol Chem. 277(13):11336-44.
  • Hino S, et al. (2005) Phosphorylation of β-Catenin by Cyclic AMP-Dependent Protein Kinase Stabilizes β-Catenin through Inhibition of Its Ubiquitination. Mol Cell Biol. 25(20):9063-72.
  • Liu X, et al. (2005) Rapid, Wnt-induced changes in GSK3beta associations that regulate beta-catenin stabilization are mediated by Galpha proteins. Curr Biol. 15(22):1989-97.
  • Kraus C, et al. (1994) Localization of the human β-catenin gene (CTNNB1) to 3p21: a region implicated in tumor development. Genomics. 23(1):272-4.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items