After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human NDRG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NDRG1cDNA Clone Product Information
cDNA Size:1185
cDNA Description:ORF Clone of Homo sapiens N-myc downstream regulated 1 DNA.
Gene Synonym:CAP43, CMT4D, DRG-1, DRG1, GC4, HMSNL, NDR1, NMSL, PROXY1, RIT42, RTP, TARG1, TDD5, NDRG1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

NDRG1 gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. NDRG1 is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. NDRG1 is necessary for p53-mediated caspase activation and apoptosis. Mutations in NDRG1 gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. NDRG1 is a stress-responsive protein involved in hormone responses, cell growth, and differentiation. It acts as a tumor suppressor in many cell types.

  • Kachhap SK, et al. (2007) The N-Myc down regulated Gene1 (NDRG1) Is a Rab4a effector involved in vesicular recycling of E-cadherin. PLoS ONE. 2(9):e844.
  • Zhang J, et al. (2008) Human differentiation-related gene NDRG1 is a Myc downstream-regulated gene that is repressed by Myc on the core promoter region. Gene. 417(1-2):5-12.
  • Kokame K, et al. (1997) Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. GRP78/BiP and novel genes. J Biol Chem. 271(47): 29659-65.