After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse EPHB4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPHB4cDNA Clone Product Information
Gene_bank_ref_id:NM_010144.6
cDNA Size:2964
cDNA Description:ORF Clone of Mus musculus Eph receptor B4 DNA.
Gene Synonym:Htk, MDK2, Myk1, Tyro11, AI042935, Ephb4
Species:Mouse
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ephrin & Eph Receptor Related Products
Product nameProduct name
Cynomolgus EphB1 / EPHT2 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinHuman Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinMouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (Fc Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)
Background

Ephrin type-B receptor 4 is a protein that in humans is encoded by the EPHB4 gene. It is a single-pass type I membrane protein belonging to the ephrin receptor subfamily of protein kinase superfamily. Members of the ephrin and Eph family are local mediators of cell function through largely contact-dependent processes in development and in maturity. Furthermore, EphB4 protein and the corresponding ligand Ephrin-B2 contribute to tumor growth in various human tumors. EphB4 protein has tumor suppressor activities and that regulation of cell proliferation, extracellular matrix remodeling, and invasive potential are important mechanisms of tumor suppression. Therefore, Ephrin-B2/EphB4 may be recognized as a novel prognostic indicator for cancers.

References
  • Davalos V, et al. (2006) EPHB4 and survival of colorectal cancer patients. Cancer Res. 66(18): 8943-8.
  • Zhao C, et al. (2006) Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metab. 4(2): 111-21.
  • Kertesz N, et al. (2006) The soluble extracellular domain of EphB4 (sEphB4) antagonizes EphB4-EphrinB2 interaction, modulates angiogenesis, and inhibits tumor growth. Blood. 107(6): 2330-8.
  • Noren NK, et al. (2007) Paradoxes of the EphB4 receptor in cancer. Cancer Res. 67(9): 3994-7.
  • Taylor AC, et al. (2007) EphB4 expression along adult rat microvascular networks: EphB4 is more than a venous specific marker. Microcirculation. 14(3): 253-67.
  • Size / Price
    Catalog:MG50582-CM
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"