After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CLEC12A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC12AcDNA Clone Product Information
Gene_bank_ref_id:NM_177686.3
cDNA Size:804
cDNA Description:ORF Clone of Mus musculus C-type lectin domain family 12, member a DNA.
Gene Synonym:Micl, CLL-1, D230024O04, Clec12a
Species:Mouse
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

CLEC12A is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. CLEC12A is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. C-type lectins are the most diverse and prevalent lectin family in immunity. Using a novel CLEC12A -specific monoclonal antibody, experiments had shown that human CLEC12A was expressed primarily on myeloid cells, including granulocytes, monocytes, macrophages, and dendritic cells. Although CLEC12A was highly N-glycosylated in primary cells, the level of glycosylation was found to vary between cell types. CLEC12A surface expression was down-regulated during inflammatory/activation conditions in vitro, as well as during an in vivo model of acute inflammation. This suggests that CLEC12A may be involved in the control of myeloid cell activation during inflammation.

References
  • Lahoud MH, et al. (2009) The C-type lectin Clec12A present on mouse and human dendritic cells can serve as a target for antigen delivery and enhancement of antibody responses. J Immunol. 182(12): 7587-94.
  • Pyz E, et al. (2008) Characterisation of murine MICL (CLEC12A) and evidence for an endogenous ligand. Eur J Immunol. 38(4): 1157-63.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36(8): 2159-69.
  • Size / Price
    Catalog:MG50558-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"