After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Ferret UBE2L6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBE2L6cDNA Clone Product Information
Gene_bank_ref_id:XM_004777586.1
cDNA Size:462
cDNA Description:ORF Clone of Mustela putorius furo (sub-species: furo) ubiquitin-conjugating enzyme E2L 6 DNA.
Gene Synonym:UBE2L6
Species:Ferret
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ferret UBE2L6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name
Background

UBCH8, also known as UBE2L6, belongs to the ubiquitin-conjugating enzyme family. The family of ubiquitin-conjugating (E2) enzymes is characterized by the presence of a highly conserved ubiquitin-conjugating (UBC) domain. These domains accommodate the ATP-activated ubiquitin (Ub) or ubiquitin-like (UBL) protein via a covalently linked thioester onto its active-site residue. E2 enzymes act via selective protein-protein interactions with the E1 and E3 enzymes and connect activation to covalent modification. By doing so, E2s differentiate effects on downstream substrates, either with a single Ub/UBL molecule or as a chain. UBCH8 is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. It catalyzes the covalent attachment of ubiquitin or ISG15 to other proteins. UBCH8 functions in the E6/E6-AP-induced ubiquitination of p53/TP53 and promotes ubiquitination and subsequent proteasomal degradation of FLT3. At protein level, it is present in natural killer cells.

References
  • Moynihan TP, et al. (1999) The ubiquitin-conjugating enzymes UbcH7 and UbcH8 interact with RING finger/IBR motif-containing domains of HHARI and H7-AP1. J Biol Chem. 274(43):30963-8.
  • Ardley HC, et al. (2000) Genomic organization of the human ubiquitin-conjugating enzyme gene, UBE2L6 on chromosome 11q12. Cytogenet Cell Genet. 89(1-2):137-40.
  • Zhao C, et al. (2004) The UbcH8 ubiquitin E2 enzyme is also the E2 enzyme for ISG15, an IFN-alpha/beta-induced ubiquitin-like protein. Proc Natl Acad. 101(20):7578-82.
  • Tripathi MK, et al. (2005) Down-regulation of UCRP and UBE2L6 in BRCA2 knocked-down human breast cells. Biochem Biophys Res Commun. 328(1):43-8.
  • Size / Price
    Catalog:FG60136-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"