After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD247 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD247 cDNA Clone Product Information
Gene_bank_ref_id:NM_000734.3
RefSeq ORF Size:495bp
cDNA Description:Full length Clone DNA of Homo sapiens CD247 molecule with N terminal His tag.
Gene Synonym:T3Z, CD3H, CD3Q, CD3Z, TCRZ, CD3-ZETA, CD247
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CD247, also known as CD3-ZETA, belongs to the CD3Z/FCER1G family. It contains 3 ITAM domains. As a -cell receptor zeta, CD247 forms the T-cell receptor-CD3 complex together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and –epsilon. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for CD247 gene. Defects in CD247 can cause immunodeficiency due to defect in CD3-zeta. An immunological deficiency characterized by T-cells impaired immune response to alloantigens, tetanus toxoid and mitogens. CD247 may play a role in assembly and expression of the TCR complex as well as signal transduction upon antigen triggering.

References
  • 1. Radstake TR, et al. (2010) Genome-wide association study of systemic sclerosis identifies CD247 as a new susceptibility locus. Nat Genet. 42(5):426-9.
  • 2. Dieud P, et al. (2011) Independent replication establishes the CD247 gene as a genetic systemic sclerosis susceptibility factor. Ann Rheum Dis. 70(9):1695-6.
  • 3. Li R, et al. (2012) Association of CD247 with systemic lupus erythematosus in Asian populations. Lupus. 21(1):75-83.
  • Size / Price
    Catalog: HG13142-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"